Details of Primer Pair 'ABC02895_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02895_L01R01441Nils Rostoks2004-01-26 ABC02895_L01 TGATCGGTCCAGTTCACCCA 534 20 Nils Rostoks 2004-01-26 Illumina
ABC02895_R01 GGAATCGCAAGCACTACGGG 974 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02895_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes