Details of Primer Pair 'ABC02972_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02972_L01R01191Nils Rostoks2005-03-17 ABC02972_L01 GAGAGACCGAGCGAGGAAAT 101 20 Nils Rostoks 2005-03-17 Invitrogen
ABC02972_R01 CTTCTTGGTGGTGTCGATCTC 292 21 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC02972_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB