Details of Primer Pair 'ABC03017_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03017_L01R01404Nils Rostoks2004-01-26 ABC03017_L01 CGTGCCGGAGAGACTTTCGT 529 20 Nils Rostoks 2004-01-26 Illumina
ABC03017_R01 GGTTCTGAAGGCTGAACCGC 932 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03017_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes