Details of Primer Pair 'ABC03024_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03024_L01R01532Nils Rostoks2004-01-26 ABC03024_L01 CAGCTACGGGTTCAGCACGA 918 20 Nils Rostoks 2004-01-26 Illumina
ABC03024_R01 CGTTCATTTCGGGGGAAACA 1449 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03024_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes