Details of Primer Pair 'ABC03043_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03043_L01R01502Nils Rostoks2004-01-26 ABC03043_L01 AGATTGCCATGGGCGCATAC 2192 20 Nils Rostoks 2004-01-26 Illumina
ABC03043_R01 CGCGTTTCTCAACCATGCAC 2693 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03043_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes