Details of Primer Pair 'ABC03057_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03057_L01R01442Nils Rostoks2004-01-26 ABC03057_L01 AAAAGAAGGCAGCGGAAGGC 849 20 Nils Rostoks 2004-01-26 Illumina
ABC03057_R01 CCTGGCCATTTGCTTTGGTC 1290 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03057_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes