Details of Primer Pair 'ABC03096_L01R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03096_L01R02296Nils Rostoks2004-05-27 ABC03096_L01 GCCGGAGAGAAGTTCCACCA 930 20 Nils Rostoks 2004-05-27 Qiagen
ABC03096_R02 GACGAACTCCCTCGCCGTG 1226 19 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC03096_L01R02'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined