Details of Primer Pair 'ABC03097_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03097_L01R01525Nils Rostoks2004-01-26 ABC03097_L01 GCCGTGAAGAAGGGGGAGAT 1201 20 Nils Rostoks 2004-01-26 Illumina
ABC03097_R01 CACAATGCTGCGAAGCAACC 1725 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03097_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes