Details of Primer Pair 'ABC03113_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03113_L01R01431Nils Rostoks2004-01-26 ABC03113_L01 GACCTCGTCGGCGTCTTCAT 702 20 Nils Rostoks 2004-01-26 Illumina
ABC03113_R01 GGAGCTGAACTCCAATTCGCA 1132 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03113_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes