Details of Primer Pair 'ABC03135_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03135_L01R01555Nils Rostoks2004-01-26 ABC03135_L01 ATGCCTACAAGCAGGCGAGC 1860 20 Nils Rostoks 2004-01-26 Illumina
ABC03135_R01 AGTCCGGCCCGTGCTTATTT 2414 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03135_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes