Details of Primer Pair 'ABC03141_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03141_L01R01441Nils Rostoks2004-01-26 ABC03141_L01 ACAAGCACCTGGGCGACTTC 1822 20 Nils Rostoks 2004-01-26 Illumina
ABC03141_R01 GTGCCTGTCGCTCTTGCCTT 2262 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03141_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes