Details of Primer Pair 'ABC03149_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03149_L01R01441Nils Rostoks2004-01-26 ABC03149_L01 CCGAAGAGGAAGCCATCGAA 1269 20 Nils Rostoks 2004-01-26 Illumina
ABC03149_R01 TGTCCACAAAACCCATGCCA 1709 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03149_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes