Details of Primer Pair 'ABC03154_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03154_L01R01588Nils Rostoks2004-05-27 ABC03154_L01 TTCCACCTGAAACGCCTTGG 659 20 Nils Rostoks 2004-05-27 Qiagen
ABC03154_R01 TCGCTGCTCTTCTTGCGTTG 71 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC03154_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined