Details of Primer Pair 'ABC03171_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03171_L01R01451Nils Rostoks2004-01-26 ABC03171_L01 AGGGAAAGGCTTAGCAGCGG 189 20 Nils Rostoks 2004-01-26 Illumina
ABC03171_R01 CGATGATGGTGCAGAGGGTG 639 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03171_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes