Details of Primer Pair 'ABC03212_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03212_L01R01428Nils Rostoks2004-01-26 ABC03212_L01 TCCGCGGACATTCTGATGAA 1510 20 Nils Rostoks 2004-01-26 Illumina
ABC03212_R01 TCCGTAGCAAACGCACGAAA 1937 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03212_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes