Details of Primer Pair 'ABC03250_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03250_L01R01434Nils Rostoks2004-01-26 ABC03250_L01 GGTGAGAAGCTGAGGGCCAA 2680 20 Nils Rostoks 2004-01-26 Illumina
ABC03250_R01 GATACAAGCAAGGCCCACGG 3113 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03250_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes