Details of Primer Pair 'ABC03253_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03253_L01R01432Nils Rostoks2004-01-26 ABC03253_L01 TCAAGCCCTTACCCTGGCTG 448 20 Nils Rostoks 2004-01-26 Illumina
ABC03253_R01 TGCACACCAACTCAGGAGCA 879 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03253_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes