Details of Primer Pair 'ABC03275_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03275_L01R01403Nils Rostoks2004-05-27 ABC03275_L01 GGTGCGTGTGAACCCTTTCC 3149 20 Nils Rostoks 2004-05-27 Qiagen
ABC03275_R01 TGGCTGGCTGGACAATGAAA 3552 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC03275_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined