Details of Primer Pair 'ABC03343_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03343_L02R02177Nils Rostoks2005-03-17 ABC03343_L02 GAAACTTTGAGGAGGGCACA 1020 20 Nils Rostoks 2005-03-17 Invitrogen
ABC03343_R02 GACGGTAGCCTGTTCGAGTT 843 20 Nils Rostoks 2005-03-17 Invitrogen

Details of Primer Pair 'ABC03343_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03343_L01R01553Nils Rostoks2004-01-26 ABC03343_L01 CTCGTCACCGGACAAGCTCA 670 20 Nils Rostoks 2004-01-26 Illumina
ABC03343_R01 CCAACACATTGGCCATGCTC 1222 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03343_L02R02'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB

Comment History of 'ABC03343_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes