Details of Primer Pair 'ABC03346_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03346_L01R01469Nils Rostoks2004-01-26 ABC03346_L01 CTTCTTAGCCCGGGGCAACT 1440 20 Nils Rostoks 2004-01-26 Illumina
ABC03346_R01 TGCAACTTGCGAAACGAACC 1908 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03346_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes