Details of Primer Pair 'ABC03381_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03381_L01R01162Nils Rostoks2005-03-17 ABC03381_L01 CAGGGACGTACAATATTACCG 507 21 Nils Rostoks 2005-03-17 Invitrogen
ABC03381_R01 AATAAGCAGGGTACCTTTTGG 345 21 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC03381_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB