Details of Primer Pair 'ABC03430_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03430_L01R01427Nils Rostoks2004-01-26 ABC03430_L01 AGAGCAAATCCAGCGGCATC 542 20 Nils Rostoks 2004-01-26 Illumina
ABC03430_R01 CCGATACAACGCACGGACAG 968 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03430_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes