Details of Primer Pair 'ABC03441_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03441_L01R01408Nils Rostoks2004-01-26 ABC03441_L01 ACCTCAGCGATGCCAAGCTC 1199 20 Nils Rostoks 2004-01-26 Illumina
ABC03441_R01 GCGCATGACCGAGATCTGAA 1606 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03441_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes