Details of Primer Pair 'ABC03443_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03443_L01R01405Nils Rostoks2004-01-26 ABC03443_L01 CTTCCAAATTGCAGCCAGGG 1789 20 Nils Rostoks 2004-01-26 Illumina
ABC03443_R01 ACTCACCTGCTCTGCCGTCC 2193 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03443_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes