Details of Primer Pair 'ABC03465_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03465_L01R01526Nils Rostoks2004-01-26 ABC03465_L01 GCGTCGCAAAGACAAGCTGA 1708 20 Nils Rostoks 2004-01-26 Illumina
ABC03465_R01 CCGCAGGCGAACCTTTACAT 2233 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03465_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes