Details of Primer Pair 'ABC03476_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03476_L01R01400Nils Rostoks2004-01-26 ABC03476_L01 TGGTAGATGCCCAGTGACCG 2651 20 Nils Rostoks 2004-01-26 Illumina
ABC03476_R01 AGCTCATGGCCTGCAGCATA 3050 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03476_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes