Details of Primer Pair 'ABC03559_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03559_L01R01551Nils Rostoks2004-01-26 ABC03559_L01 AACAATTCCCGCTGTGGCAT 1580 20 Nils Rostoks 2004-01-26 Illumina
ABC03559_R01 ATGCGCACGTTCCTCGTACA 2130 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03559_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes