Details of Primer Pair 'ABC03594_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03594_L01R01419Nils Rostoks2004-01-26 ABC03594_L01 AGAGGAAGTTCGGCGTGTCG 589 20 Nils Rostoks 2004-01-26 Illumina
ABC03594_R01 TGGGGCTGTTTGAGACGGAT 1007 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03594_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes