Details of Primer Pair 'ABC03646_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03646_L01R01484Nils Rostoks2004-05-27 ABC03646_L01 GCACCGTCCTTCAGAAAACATG 1815 22 Nils Rostoks 2004-05-27 Qiagen
ABC03646_R01 CCTGCTTTTGACATGCGGAATC 1331 22 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC03646_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined