Details of Primer Pair 'ABC03810_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03810_L01R01488Nils Rostoks2004-01-26 ABC03810_L01 AGGTCGTCCACTACTGCGCC 834 20 Nils Rostoks 2004-01-26 Illumina
ABC03810_R01 TTGGACCAACCGTGTGCTTG 1321 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03810_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes