Details of Primer Pair 'ABC03814_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03814_L01R01494Nils Rostoks2004-01-26 ABC03814_L01 GTGATGGGACTCGCTTCGGT 2182 20 Nils Rostoks 2004-01-26 Illumina
ABC03814_R01 GCTCTTTGCGTACCCATGCC 2675 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03814_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes