Details of Primer Pair 'ABC03835_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03835_L01R01515Nils Rostoks2004-01-26 ABC03835_L01 GGGCGGTATCAGAGGTGCAG 1603 20 Nils Rostoks 2004-01-26 Illumina
ABC03835_R01 GCATGCACGCAGCAAGACTC 2117 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03835_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes