Details of Primer Pair 'ABC03900_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03900_L01R01526Nils Rostoks2004-01-26 ABC03900_L01 GAGCTCAACCACGCCATCAC 939 20 Nils Rostoks 2004-01-26 Illumina
ABC03900_R01 GCGGTGAAATATGCAACCCAA 1464 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC03900_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes