Details of Primer Pair 'ABC03906_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC03906_L01R01111Nils Rostoks2005-03-17 ABC03906_L01 ACCATGTCTTCCCCAAGC 114 18 Nils Rostoks 2005-03-17 Invitrogen
ABC03906_R01 GGAAGTGGACGAAGAACTCC 225 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC03906_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB