Details of Primer Pair 'ABC04056_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04056_L01R01141Nils Rostoks2005-03-17 ABC04056_L01 CCCATGAAGCCTCTTTACG 350 19 Nils Rostoks 2005-03-17 Invitrogen
ABC04056_R01 GGAACGGAGGGAGTATTAAGC 491 21 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC04056_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB