Details of Primer Pair 'ABC04135_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04135_L01R01477Nils Rostoks2004-01-26 ABC04135_L01 GCTGAGCAACCTTGGTGCAA 746 20 Nils Rostoks 2004-01-26 Illumina
ABC04135_R01 TCATCTTGCATGTCGGCACA 1222 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04135_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes