Details of Primer Pair 'ABC04158_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04158_L01R01469Nils Rostoks2004-01-26 ABC04158_L01 TCAGATGCCACGAACCCAAA 1223 20 Nils Rostoks 2004-01-26 Illumina
ABC04158_R01 GCGCAGTACAGCTTCTTGGGA 1691 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04158_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes