Details of Primer Pair 'ABC04163_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04163_L01R01170Nils Rostoks2005-03-17 ABC04163_L01 GAAGAAACAACCCAACTTCC 44 20 Nils Rostoks 2005-03-17 Invitrogen
ABC04163_R01 AGGATCGTACGAAGAACAGC 214 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC04163_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB