Details of Primer Pair 'ABC04187_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04187_L01R01426Nils Rostoks2004-01-26 ABC04187_L01 CGACAGATGGGCCTCCTACG 792 20 Nils Rostoks 2004-01-26 Illumina
ABC04187_R01 TGAGCGGAGAACGACGAGTG 1217 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04187_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes