Details of Primer Pair 'ABC04220_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04220_L01R01432Nils Rostoks2004-01-26 ABC04220_L01 TACAAGCCGCTAGCCCCGTA 1164 20 Nils Rostoks 2004-01-26 Illumina
ABC04220_R01 CAGCTTTCCTCACCGCGTCT 1595 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04220_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes