Details of Primer Pair 'ABC04240_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04240_L01R01565Nils Rostoks2004-05-27 ABC04240_L01 CTCGACAAGTCCGGCGAGAT 860 20 Nils Rostoks 2004-05-27 Qiagen
ABC04240_R01 GGATGGGTTCCCACAACGAA 295 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC04240_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined