Details of Primer Pair 'ABC04260_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04260_L01R01194Nils Rostoks2005-03-17 ABC04260_L01 CACCGACCCATGGAAATAAC 1225 20 Nils Rostoks 2005-03-17 Invitrogen
ABC04260_R01 CGAGGTCGTCAAGATGGACT 1031 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC04260_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB