Details of Primer Pair 'ABC04273_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04273_L01R01445Nils Rostoks2004-01-26 ABC04273_L01 ACGTGCCCATCGTTCCAAAT 805 20 Nils Rostoks 2004-01-26 Illumina
ABC04273_R01 ACCACACAAGCTGCCCAACA 1249 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04273_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes