Details of Primer Pair 'ABC04282_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04282_L01R01400Nils Rostoks2004-01-26 ABC04282_L01 ATGACGCTGCAAGAGAGGGG 540 20 Nils Rostoks 2004-01-26 Illumina
ABC04282_R01 AATCAGAGTCCAGCGGGCAG 939 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04282_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes