Details of Primer Pair 'ABC04312_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04312_L01R01183Nils Rostoks2005-03-17 ABC04312_L01 CCTCCATGAAACCCTTCCTT 766 20 Nils Rostoks 2005-03-17 Invitrogen
ABC04312_R01 GTGGAGTGGGTCCTCAAGAA 583 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC04312_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB