Details of Primer Pair 'ABC04317_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04317_L01R01471Nils Rostoks2004-01-26 ABC04317_L01 TCACCATCACCCACCACCAC 1193 20 Nils Rostoks 2004-01-26 Illumina
ABC04317_R01 CAGCGGAAGGAACAGCACCT 1663 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04317_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes