Details of Primer Pair 'ABC04320_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04320_L01R01443Nils Rostoks2004-01-26 ABC04320_L01 GGATGAACCAGATCACCGGC 884 20 Nils Rostoks 2004-01-26 Illumina
ABC04320_R01 GCATGCGCTGTCACCTCACT 1326 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04320_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes