Details of Primer Pair 'ABC04322_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04322_L01R01456Nils Rostoks2004-01-26 ABC04322_L01 AGCCAGCCAGGTCGTGAGAG 491 20 Nils Rostoks 2004-01-26 Illumina
ABC04322_R01 GCAGGTGCGGTGTCTCAGTG 946 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04322_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes