Details of Primer Pair 'ABC04337_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04337_L01R01405Nils Rostoks2004-01-26 ABC04337_L01 CAACGTGACGACGGAGATCG 788 20 Nils Rostoks 2004-01-26 Illumina
ABC04337_R01 ACGGACACCGACTAGCCAGC 1192 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04337_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes