Details of Primer Pair 'ABC04538_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04538_L01R01577Nils Rostoks2004-01-26 ABC04538_L01 ACCGTCGAGAACTTCCGTGC 41 20 Nils Rostoks 2004-01-26 Illumina
ABC04538_R01 CGCATTTTATTCCGGGCAAA 617 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04538_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes